Giraffa tippelskirchi Matschie, 1898
- Dataset
- GBIF Backbone Taxonomy
- Rank
- SPECIES
- Published in
- Matschie, Paul. 1898. Einige anscheinend noch nicht beschrieben Säugethiere aus Afrika. Sitzungsberichte der Gesellschaft Naturforschender Freunde zu Berlin 1898: 75–81.














































Classification
- kingdom
- Animalia
- phylum
- Chordata
- class
- Mammalia
- order
- Artiodactyla
- family
- Giraffidae
- genus
- Giraffa
- species
- Giraffa tippelskirchi
diagnosis
Diagnosis Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN 2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T => A, 318 G => C, 332 T => G, 504 A => C, 623 C => T
discussion
Remarks Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost.
distribution
Distribution Kenya, Tanzania (lectotype), Zambia.
materials_examined
Type material Lectotype (here designated) TANZANIA • 1 specimen (skull and skin); Lake Eyasi; ZMB- 084951.
Giraffa tippelskirchi
; (2) Masai giraffe (G. tippelskirchi),
which includes the formerly recognized Thornicroft’s giraffe;
Name
- Synonyms
- Giraffa camelopardalis thornicrofti Lydekker, 1911
- Giraffa camelopardalis tippelskirchi Matschie, 1898
- Homonyms
- Giraffa tippelskirchi Matschie, 1898
- Common names
- Masai Giraffe in English
- Masai Giraffe in English
Bibliographic References
- Fennessy, Julian, Tobias Bidon, Friederike Reuss, Vikas Kumar, Paul Elkan, Maria A. Nilsson, et al., 2016: Multi-locus Analyses Reveal Four Giraffe Species Instead of One. Current Biology, vol. 26. 1-7.