We’re sorry, but GBIF doesn’t work properly without JavaScript enabled.
Our website has detected that you are using an outdated insecure browser that will prevent you from using the site. We suggest you upgrade to a modern browser.
{{nav.loginGreeting}}
  • Get data
      • Occurrences
      • Species
      • Datasets
      • Trends
  • How-to
    • Share data

      • Quick-start guide
      • Dataset classes
      • Data hosting
      • Standards
      • Become a publisher
      • Data quality
      • Data papers
    • Use data

      • Featured data use
      • Citation guidelines
      • GBIF citations
      • Citation widget
  • Tools
    • Publishers

      • IPT
      • Data validator
      • Suggest a dataset
      • Scientific Collections
    • Users

      • GBIF API
      • Data processing
      • rgbif
      • MAXENT
      • Tools catalogue
    • GBIF labs

      • Species matching
      • Name parser
      • Sequence ID
      • Relative observation trends
      • GBIF data blog
  • Community
    • Network

      • Participants
      • Nodes
      • Publishers
      • Network contacts
      • Community forum
      • alliance for biodiversity knowledge
    • Volunteers

      • Mentors
      • Ambassadors
      • Translators
      • Citizen scientists
    • Activities

      • Capacity enhancement
      • Training and e-Learning
      • Programmes & projects
      • Living Atlases
  • About
    • Inside GBIF

      • What is GBIF?
      • Become a member
      • Governance
      • Funders
      • Partnerships
      • Release notes
      • Implementation plan
      • Contacts
    • News & outreach

      • News
      • Newsletters and lists
      • Events
      • Ebbe Nielsen Challenge
      • Young Researchers Award
      • Science Review
  • User profile

Microbial soil Fungi (ITS2) diversity from Maritime Antarctica

Citation

Newsham K, Hopkins D, Carvalhais L, Fretwell P, Rushton S, O'Donnell A, Dennis P, Sweetlove M (2019). Microbial soil Fungi (ITS2) diversity from Maritime Antarctica. Version 1.2. SCAR - Microbial Antarctic Resource System. Metadata dataset https://doi.org/10.15468/fdh2mt accessed via GBIF.org on 2021-01-25.

Description

Amplicon sequencing dataset (454) of microbial fungi (ITS2 marker gene) in soils from the Antarctic Peninsula and Maritime Antarctic Islands.

Sampling Description

Study Extent

Soils without plant cover were sampled along the climatic gradient in Maritime Antarctica.

Sampling

The uppermost five centimetres of soil was collected in 50 ml DNA/RNAase-treated plastic tubes (30 mm diam.) from each of five locations at each site and was bulked. The soil was then immediately snap-frozen by immersion in a mixture of dry ice and ethanol (c. -80 °C). Samples were maintained at -80 °C from the time of sampling until they were processed.

Method steps

  1. Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax® Soil DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) as per the manufacturer’s instructions. The internal transcribed spacer 2 (ITS2) region of the ribosomal RNA encoding genes was amplified by polymerase chain reaction (PCR) using the primers gITS7 (5′ GTGARTCATCGARTCTTTG27) and ITS4 (5′ TCCTCCGCTTATTGATATGC28), which target sites in the 5.8S gene and ribosomal large subunit, respectively. The gITS7 primer was 5’-labelled with the 454 FLX sequencing primer adapter B sequence and the ITS4 primer was 5’-labelled with a sample specific barcode sequence and the 454 FLX sequencing primer adapter A sequence. PCRs were performed in duplicate 50 μl reactions, each containing 5 ng template DNA, 1X Phusion® High Fidelity PCR Buffer (New England Biolabs Inc.), 0.2 mM of each of the dNTPs (Invitrogen), 0.3 μM of the ITS4 primer, 0.5 μM of the gITS7 primer, and 1U of 1X Phusion® High Fidelity DNA Polymerase (New England Biolabs Inc.). Thermocycling conditions were as follows: 98 °C for 30 s, 35 cycles of 98 °C for 10 s, 56 °C for 30 s, 72 °C for 15 s and a final extension at 72 °C for 7 min. Negative controls, consisting of sterile water in place of template DNA, did not yield amplicons. Amplicons were purified using a Wizard® SV Gel and PCR Clean-Up System (Promega), quantified with a Qubit fluorometer with a Quant-iT dsDNA HF assay kit and then 72 ng of each sample was pooled. The pooled sample was purified again using a QIAquick PCR Purification Kit (Qiagen), and then sent to Macrogen (Seoul, Korea) for 454 pyrosequencing.

Taxonomic Coverages

microbial soil Fungi, ITS2 marker gene
  1. Fungi
    common name: Fungi rank: phylum

Geographic Coverages

Soil samples from the Antarctic Peninsula and Maritime Antarctic Islands.

Bibliographic Citations

  1. Newsham, K. K., Hopkins, D. W., Carvalhais, L. C., Fretwell, P. T., Rushton, S. P., O’Donnell, A. G., & Dennis, P. G. (2016). Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nature Climate Change, 6(2), 182. -

Contacts

Kevin Newsham
originator
British Antarctic Survey
Cambridge
GB
David Hopkins
originator
The Royal Agricultural University
Cirencester
GB
Lilia Carvalhais
originator
The University of Queensland
Brisbane
AU
Peter Fretwell
originator
British Antarctic Survey
Cambridge
GB
Steven Rushton
originator
Newcastle University
Newcastle upon Tyne
GB
Anthony O'Donnell
originator
University of Western Australia
Crawley
AU
Paul Dennis
originator
The University of Queensland
Brisbane
AU
Maxime Sweetlove
metadata author
position: Research assistent
Royal Belgian Institute for Natural Sciences
Rue Vautier 29
Brussels
1000
BE
email: msweetlove@naturalsciences.be
Kevin Newsham
administrative point of contact
British Antarctic Survey
Cambridge
GB
Paul Dennis
administrative point of contact
The University of Queensland
Brisbane
AU
What is GBIF? API FAQ Newsletter Privacy Terms and agreements Citation Code of Conduct Acknowledgements
Contact GBIF Secretariat Universitetsparken 15 DK-2100 Copenhagen Ø Denmark